Category Archives: sequences

Molecular Biology, sequences, Shotgun DNA Mapping

Resuspending Oligos from @idtdna (with resuspension calculator)

Leave a comment

I created myself a resuspension calculator that calculates the actual measured concentration from what it should be. IDT has a resuspension calculator that seems to just take the nmole amount and divide it by 1000 to give you the amount to add in ml. My calculator does the same thing, and allows me to input nanodrop values to get a nanodrop measured calculation. Here are the calculations for these oligos:

Also if it isn’t apparent from the spreadsheet, my resuspension buffer is just 0.1x TE buffer. All calculations are in the spreadsheet which is publicly available to make copies of as you see fit.

KochLab Stuff, Molecular Biology, sequences, Shotgun DNA Mapping

Ordering the Oligos

Leave a comment

I am placing an order for the oligos and primers needed for Shotgun DNA Mapping. Here are the sequences I’m going to order:

  • F834-dig: 5′ – TTTTCCCAGTCACGACGTTG – 3′
  • R2008-bio: 5′ – CACGTAAGGTTTCAGAGATATATGGG – 3′
  • F50-bio: 5′ – TGTGTCGCCCTTAGGTACGAACT – 3′
  • R4000-dig: 5′ – TTCGCTCCAAGCTGGGCTGTGTG – 3′
  • Top Adapter: 5′ – Phos – GCTGTCTGAATTCTAATGTAGTATAGTAATCCGCTCATCG – 3′
  • Bottom 1a:
    1. 5′ – GAGCGGATXACTATACTACATTAGAATTCAGAC – 3′, where X=dT-Biotin
    2. 5′ – biotin – GAGCGGATTACTATACTACATTAGAATTCAGAC – 3′

I’m ordering from Integrated DNA Technologies. I was going to order three different versions of the bottom adapter, but decided to just get the two listed above. The one I omitted from the order is the 5′-bio with the floppy overhang (which won’t ligate to anything). Once I get my second supply of money from IMSD I’ll order that oligo.

 

Molecular Biology, sequences, Shotgun DNA Mapping

The unzipping adapter sequences

Leave a comment

Every time I order adapter sequences, I need to go through the same process. This page lists all the sequences used for the unzipping construct’s adapter duplex. The issue is that I only ever need two sequences: a top and a bottom. The top adapter is easy to pick, but the bottom adapter has two possible solutions and I always forget which one. For this I’ll need to reference some order forms to see what I used last time.

Anyways. The top adapter I need is:

  • Top Adapter BstXI/SapI – this adapter has the complementary overhangs for both the BstXI site on the anchor DNA and the SapI site on the unzipping DNA.

And it looks like the bottom adapter I need is the one labeled Bottom Adapter 1a. I’m guessing it is that because: (1) the top adapter on the page is shown annealed to this bottom, and (2) I reference it on this page.

Ok, I’ve verified that the bottom adapter I use most frequently is:

  • Bottom Adapter 1a – which I’ve most recently developed two versions of:
    • GAGCGGATXACTATACTACATTAGAATTCAGAC – this is the original sequence, and the X is actually a dT-biotin (dT is deoxyribonucleotide thymine)
    • TXTXTXAGAGCGGATTACTATACTACATTAGAATTCAGAC – Bottom Adapter 5′ biotin, floppy named because the TXTXTXA is an addition to the 5′ end of the original sequence. The X’s are dT-biotin
    • GAGCGGATTACTATACTACATTAGAATTCAGAC – Bottom 5′-biotin adapter named because I’ve removed the dT-biotin and put the biotin at the 5′ end of the sequence.

So unfortunately the verification process I went through is not open. I had to pull my order forms to Alpha DNA to confirm the sequences. Once I found and confirmed the sequences I emailed them to myself. And now I’m posting them here so the entire record is complete. ONS rules!

Anyway, I never remember what Bottom Adapter 1b is for, but I suppose it is not necessary. In the mean time I found a bunch of older notebook entries that contain information about the bottom adapters:

  • 11/4/09
  • BstXI adapter – I made an adapter to ligate the anchor to itself, and I reference the original bottom adapter called Bottom biotin. I don’t say which one it is, but I’m pretty sure it’s 1a.

I had some other links, but they were either confusing or referred to the bottom adapter without specifying each one. And it is tough searching OWW for the CATG version (1b). Maybe Koch knows? I’ll do some digging later. Research is fun!

Molecular Biology, sequences, Shotgun DNA Mapping

Anchor DNA Sequences

Leave a comment

See here for the background behind everything contained below. Note: For now I’m going to link sequences from OWW here. I was going to put the entire sequence, but that would make this page sorta sloppy and it could get lost. So I’m going to make a page that contains all the sequences necessary for Shotgun DNA Mapping.

  • pRL574– This is a non-commercial plasmid provided by Robert Landick. We have a very small supply so I will have to do some cloning to make an infinite supply!
    • primers – according to notes that I have on OWW and Google Docs I’ve had success with F834-dig as the forward primer (and might be the only primer I have in the lab), R2008 and R1985 as the reverse primers. The difference between the two reverse primers is the length of the PCR sequence, which turns out to be a difference of 23bp.
  • pALS– designed by me, purchased and built by DNA 2.0. I’ should have enough for a few PCR reactions, but I may need to clone to replenish my stocks.
    • primers – primer R4500 would bind in two places on the plasmid so I made R4000 to fix this issue. I’ll have to check my paperwork to see which primer has the dig. I think it is supposed to be on the reverse end, but I can’t be sure.