Tag Archives: equipment

Shotgun DNA Mapping: Microspheres

Today I need to buy microspheres. In the first experiments we used spheres with a diameter of 0.5um (or 500nm), and over time we eventually switched to using 1.0um beads. The reason is because: 1) big beads are easier to see if they are tethered or not, 2) you get better tweezer forces with the larger beads, and 3) the big beads clump less. The only drawback to using the larger beads is that there is a lot of repulsion between the beads and our glass surface so our DNA tethers need to be longer. I invented the 4kb pALS anchor to solve this very problem.

Here are some pictures of the different sized beads in the tethering environment:

And for completeness here are some old notebook entries regarding those pictures:

And here is a video that shows the tethering results of the DNA experiments listed above:

We want beads that are coated in streptavidin (or some form of avidin) because this molecule creates a very strong bond with biotin which is attached to our DNA for stretching/unzipping experiments.Most commonly, you can order beads with streptavidin, but some companies offer alternatives like avidin or neutravidin. In my experience neither works any better or worse than streptavidin. And in the case of these experiments the bond either holds or it doesn’t.

But believe it or not, it is hard to quantify the effectiveness of the beads. As you can see in the pictures above, both bead concentration and DNA concentration can affect tethering efficiency. And I have suspicions that the sonication process (what we do to prevent the beads from clumping) may affect the streptavidin in some way: in my head the vibration shakes off the molecules from the beads.

With all that said, there are places that I trust buying beads from. In the past I’ve purchased beads from Bangs Labs, Invitrogen, and Poly Sciences. I’ve never noticed that any bead from any company seems to work better than the rest. Because of this I think I’ll order a new stock of beads from Bangs because they pretty much only make beads (so they should do it the best). Note: I just remembered that Bangs, and Poly Sciences may be the same company and it turns out they are affiliated in some way. So I suppose there really is no difference between the two.

Update: I’m placing my order with Bangs Labs. I’m ordering 0.53um beads and 1.04um beads, both coated in streptavidin, and neither are fluorescent.

Ordering supplies for Shotgun DNA Mapping

Here is a list of components that are needed for this project:

  1. Anchor DNA:

    1. pRL574 – provided to us by Robert Landick
    2. pALS – purchased through DNA 2.0
    3. primers for both pRL574 and pALS
      1. F834-dig: 5′ – TTTTCCCAGTCACGACGTTG – 3′
      2. R2008-bio: 5′ – CACGTAAGGTTTCAGAGATATATGGG – 3′
      3. F50 (can order with or without Biotin): 5′ – TGTGTCGCCCTTAGGTACGAACT – 3′
      4. R4000 (can order with or without dig): 5′ – TTCGCTCCAAGCTGGGCTGTGTG – 3′
  2. Adapter DNA:
    1. Top Adapter: 5′ – GCTGTCTGAATTCTAATGTAGTATAGTAATCCGCTCATCG – 3′
      1. make sure the 5′ end is phosphorylated otherwise the ligation may fail
    2. Bottom 1a: 5′ – GAGCGGATXACTATACTACATTAGAATTCAGAC -3′
      1. X = dT-biotin
      2. Alternate versions of Bottom
        1. 5′ – TXTXTXAGAGCGGATTACTATACTACATTAGAATTCAGAC -3′
          1. X = dT-biotin
        2. 5′ – biotin – GAGCGGATTACTATACTACATTAGAATTCAGAC – 3′
  3. Molecular Biology Components
    1. PCR Supplies:
      1. Taq/OneTaq – I had amazing success with OneTaq so I may get this
      2. dNTPs
      3. MgCl2
      4. PCR buffer
    2. Digestion components
      1. BstXI
      2. SapI
      3. EarI
    3. Ligation
      1. T4 DNA Ligase
    4. Gel Components
      1. EtBr
      2. SybrSafe

The unzipping adapter sequences

Every time I order adapter sequences, I need to go through the same process. This page lists all the sequences used for the unzipping construct’s adapter duplex. The issue is that I only ever need two sequences: a top and a bottom. The top adapter is easy to pick, but the bottom adapter has two possible solutions and I always forget which one. For this I’ll need to reference some order forms to see what I used last time.

Anyways. The top adapter I need is:

  • Top Adapter BstXI/SapI – this adapter has the complementary overhangs for both the BstXI site on the anchor DNA and the SapI site on the unzipping DNA.

And it looks like the bottom adapter I need is the one labeled Bottom Adapter 1a. I’m guessing it is that because: (1) the top adapter on the page is shown annealed to this bottom, and (2) I reference it on this page.

Ok, I’ve verified that the bottom adapter I use most frequently is:

  • Bottom Adapter 1a – which I’ve most recently developed two versions of:
    • GAGCGGATXACTATACTACATTAGAATTCAGAC – this is the original sequence, and the X is actually a dT-biotin (dT is deoxyribonucleotide thymine)
    • TXTXTXAGAGCGGATTACTATACTACATTAGAATTCAGAC – Bottom Adapter 5′ biotin, floppy named because the TXTXTXA is an addition to the 5′ end of the original sequence. The X’s are dT-biotin
    • GAGCGGATTACTATACTACATTAGAATTCAGAC – Bottom 5′-biotin adapter named because I’ve removed the dT-biotin and put the biotin at the 5′ end of the sequence.

So unfortunately the verification process I went through is not open. I had to pull my order forms to Alpha DNA to confirm the sequences. Once I found and confirmed the sequences I emailed them to myself. And now I’m posting them here so the entire record is complete. ONS rules!

Anyway, I never remember what Bottom Adapter 1b is for, but I suppose it is not necessary. In the mean time I found a bunch of older notebook entries that contain information about the bottom adapters:

  • 11/4/09
  • BstXI adapter – I made an adapter to ligate the anchor to itself, and I reference the original bottom adapter called Bottom biotin. I don’t say which one it is, but I’m pretty sure it’s 1a.

I had some other links, but they were either confusing or referred to the bottom adapter without specifying each one. And it is tough searching OWW for the CATG version (1b). Maybe Koch knows? I’ll do some digging later. Research is fun!

Anchor DNA Sequences

See here for the background behind everything contained below. Note: For now I’m going to link sequences from OWW here. I was going to put the entire sequence, but that would make this page sorta sloppy and it could get lost. So I’m going to make a page that contains all the sequences necessary for Shotgun DNA Mapping.

  • pRL574– This is a non-commercial plasmid provided by Robert Landick. We have a very small supply so I will have to do some cloning to make an infinite supply!
    • primers – according to notes that I have on OWW and Google Docs I’ve had success with F834-dig as the forward primer (and might be the only primer I have in the lab), R2008 and R1985 as the reverse primers. The difference between the two reverse primers is the length of the PCR sequence, which turns out to be a difference of 23bp.
  • pALS– designed by me, purchased and built by DNA 2.0. I’ should have enough for a few PCR reactions, but I may need to clone to replenish my stocks.
    • primers – primer R4500 would bind in two places on the plasmid so I made R4000 to fix this issue. I’ll have to check my paperwork to see which primer has the dig. I think it is supposed to be on the reverse end, but I can’t be sure.

Using cuvettes in the nanodrop

I did a mini-study this morning to find out what the minimum volume needed is to get an accurate reading in the nanodrop. I have 2 different cuvettes (semi-micro and micro) and I wanted to impact the cultures the least so I would like to use the micro cuvettes.

image
From left: 400ul in semi-micro cuvette, 200ul in micro cuvette, 500ul in semi-micro cuvette

I used 5 semi-micro cuvettes and 2 micro cuvettes. I put increments of 100ul starting at 100ul in each cuvette (100 -> 500ul in the semi-micro and 100 and 200ul in the micro cuvette). At and above 400ul the nanodrop was able to effectively and consistently read the absorbance of the semi-micro cuvette (verified because the readings for 400 and 500ul were identical). For the micro cuvette, I looked at the profile (image above) and saw by eye that the height of the meniscus of the liquid media was roughly equivalent to the height in the semi-micro cuvette with 500ul. So I put this in the nanodrop and got an equivalent absorbance reading.

So in summary:

  • For semi-micro cuvettes (and the Thermo Nanodrop 2000c), volumes of at least 400ul or more are sufficient for consistent readings.
  • For micro cuvettes, volumes of 200ul are sufficient for consistent readings.

The End.

Experiments’ Product Page Updated

I’ve been slacking with keeping up with the equipment that I use in the lab, but I have updated the product page and it should be all up to date with the latest string of experiments. Let me know if you notice I’m missing something.

Fixing the incubator

Warning: My phone takes some bewilderingly bad pictures, and unfortunately all images in this post were taken with said phone. I have a Droid Bionic, so if you are on the fence about phones and want a good camera, this is not the phone for you.

Onto the protocol…

So I noticed that our incubator/shaker (Innova 4300) wouldn’t shake. The display would read “LID” indicating that the lid was open even though it was closed. Usually I just lean on the top and presto! But this time no amount of force would register as closed. So I had to figure out what part of the shaker registers the lid as closed. Here is what I noticed:

It seems there are two sensors that must make contact between the base of the machine and the lid. Here are pictures of the pieces and their contact points:

image
sensor on lid on right side.
image
sensor contact on base on right side
image
sensor on base on left side
image
sensor contact on lid on left side

So no matter how much pressure I put on the lid, one of these contacts was not making contact. I checked and it was the one on the right side:

image
see the space?

And if you see in that picture, there are screws on each side of that cylinder. So I unscrewed each one and was able to pull the plate off and push the sensor down some. I put the plate and the screws back on and put the lid down. Then the machine seemed to work.

The caveat is that the sensor thing right now isn’t making contact between the lid and the base, and the machine still works, so I’m thinking that even though what I did was mighty, it really had no effect. But my question is, if that thing is not a sensor, then why are there wires that attach to it? (I didn’t mention that before, but that is why I assumed this thing was a sensor.)

Anyways, the shaker gives me no issues now. So for your viewing pleasure here are some other pictures I took to that I sent from my phone in case I needed them, don’t really, but want to show you anyway:

image
the inside of our shaker
image
blurry and dark image of the left sensor making contact with the lid
image
another blurry image of the same sensor.

Hopefully this post is useful to someone, or someone can see that I clearly have no idea what I’m doing and can explain to me why the lid would fail to register as closed and then I adjust a seemingly meaningless piece and now it registers as closed, even though it isn’t touching anything.