Tag Archives: equipment

Glycerol Stock Creation

I made glycerol stocks of the yeast that started the entire D2O adaptation experiment, and now that I may have a D2O adapted strain I made another glycerol stock for safeguarding. I used the protocol found here for reference, with the exception that I doubled the recipe.

Shotgun DNA Mapping Buffers

I worked with Pranav to make some H2O and D2O buffers for the shotgun DNA mapping experiment. We use a buffer that we call Popping Buffer for our tethering experiment. The name comes from the fact that this buffer was used during Koch’s (and potentially others’) experiments that involved “popping” bound proteins off DNA while unzipping. The buffer is (final concentration):

  • 50mM NaCl
  • 50mM Sodium Phosphate (which is a mixture of dibasic and monobasic sodium phosphate)
  • 10mM EDTA
  • 0.02% Tween-20

We made two 100ml amounts of solution in D2O and H2O respectively. And the buffers were concocted from separately made solutions in each water type:

  • 4M NaCl was made as a solution in both D2O and H2O
  • 500mM Sodium Phosphate (monobasic) in D2O and H2O
  • 500mM Sodium Phosphate (dibasic) in D2O and H2O
  • 100mM EDTA in D2O and H2O

From some Popping Buffer we made BGB (Blotting Grade Blocker) in both D2O and H2O at a concentration of 5mg/ml (about 15ml volume). And we also made aliquots of anti-dig in PBS (from only H2O, since we aliquot 20ul amounts and then add 180ul of Popping buffer when it is experiment time).

Thermo PCR Sprint (“ThermoCycler”) Programmed T vs Recorded T

This experiment is a follow up to yesterday’s experimental results. Instead of trying to program the ThermoCycler by guessing, I decided to record the temperatures of various different T settings. Basically I would pick a T and try to get the recorded value near the T’s needed for the pALS PCR protocol.

I put the machine in manual mode so I can change the T when I needed to and I would take data points at 30 seconds for melting and annealing temperatures and at 30s and 5 minutes for extending T. This is how long I would be doing that step during the PCR reaction so it seemed to make sense. Below is a chart of the Set T and the recorded T at each interval.

Below that is the data of the recorded T.

The recorded temperatures of the PCR Sprint thermal cycler.

Figshare Data:

PCR Sprint Programmed T vs Recorded T. Anthony Salvagno. figshare.
Retrieved 18:51, Aug 23, 2012 (GMT)
http://dx.doi.org/10.6084/m9.figshare.94414

Testing the pcr machines

Today is going to be dedicated to getting temperature readings from the PCR machines (both OpenPCR and the ThermoCycler). Both machines have their own temperature output, but in the past I’ve discovered that they don’t really reflect the temp inside the PCR reaction tube (especially with regards to the ThermoCycler). The last time I did this with the ThermoCycler, I got some interesting results which led to my current program settings.

Today I’m going to repeat that experiment and replicate it with OpenPCR. Here is my setup:

  • You will need:
    1. a PCR machine
    2. reaction tubes
    3. a thermocouple – These are pretty easy to find
    4. a temperature reader – I’ve used digital multimeters in the past, but for this experiment I’m using the TC-48-20 OEM because it comes with software that takes frequent measurements and allows me to export the data.
  1. Take a PCR reaction tube and drill a small hole in it
  2. Put either water or mineral oil in the tube (in the amount that you normally use for PCR reactions), I’m doing 50ul for this experiment.
  3. Put the thermocouple in the tube through the drilled hole and place the tube in the block on the PCR machine.
  4. Connect the thermocouple to your temperature reader (in my case I need to connect the temp probe to the TC-48-20 and then connect that to my computer)
  5. Run the PCR program and collect data.

Check out the images below:

image
From right: a small drill bit, a PCR reaction tube, and a 15k thermocouple
image
Once you drill the hole, add some water (or mineral oil) to the reaction tube, and then put the thermocouple in through the drilled hole.
image
The temperature controller with only the temp probe and computer connected
image
The connection between the temp probe and the temp controller.
image
The entire setup: OpenPCR, temp controller, computer with software.

Need to get anti-dig

I have some anti-dig in our -80C Freezer and I’ve discovered that it is almost 3 years old. This probably isn’t that big a deal, but since I’m starting from scratch I would have let it slide if it was a year old. It’s not. So this will be ordered today.

The real reason I wrote this notebook entry was partly to declare that I’m ordering new anti-dig, but also because I was super stoked that I googled “anti-dig openwetware” and the notebook entry I linked above was the #1 hit. It’s good to know that my old notebook and new one are both making an impact in the scientific world.

This is what I’m ordering: Anti-dig

Shotgun DNA Mapping DNA Supplies

I had to do a bit of reorganizing. Since I’ve been reordering new supplies, I can easily get confused between what I need and what I don’t. So I’m conglomerating all the things that I do into one box and everything else will get shoveled away to be lost for all eternity. Here is a picture of the items that I need immediately and what they are:

image
Top Row (from left): 100ng/ul pALS (1/2011), 100ng/ul pALS (8/2012), 1.5ng/ul pALS (for PCR use, from 1/2011), R4000-no-label 207uM (2011), R4000 107uM (2011), F50 50uM (2011), F50-no-label 214uM (2011)
Row Two (from left): lambda DNA 500ug/ml, 1kb ladder, 1kb ladder, 100bp ladder, pUC19 100pg/ul, 10um R4000-no-label (2011), 10uM R4000 (2011), 10uM F50 (2011), 10uM F50-no-label (2011)
Row Three (from left): pBluescript II KS (-) 1ug/ml, pBR322 1mg/ml, 10uM R4500 (2011), 187uM R4500 (2011)
Row Four: SpBR >200nM

Update:

  • Added Top Adapter (from IDT) – 530uM 8/13/2012
  • Measured concentrations of pALS – pALS from 1/2011 is 96ng/ul; pALS from 8/2012 is 160ng/ul

Ordering the Oligos

I am placing an order for the oligos and primers needed for Shotgun DNA Mapping. Here are the sequences I’m going to order:

  • F834-dig: 5′ – TTTTCCCAGTCACGACGTTG – 3′
  • R2008-bio: 5′ – CACGTAAGGTTTCAGAGATATATGGG – 3′
  • F50-bio: 5′ – TGTGTCGCCCTTAGGTACGAACT – 3′
  • R4000-dig: 5′ – TTCGCTCCAAGCTGGGCTGTGTG – 3′
  • Top Adapter: 5′ – Phos – GCTGTCTGAATTCTAATGTAGTATAGTAATCCGCTCATCG – 3′
  • Bottom 1a:
    1. 5′ – GAGCGGATXACTATACTACATTAGAATTCAGAC – 3′, where X=dT-Biotin
    2. 5′ – biotin – GAGCGGATTACTATACTACATTAGAATTCAGAC – 3′

I’m ordering from Integrated DNA Technologies. I was going to order three different versions of the bottom adapter, but decided to just get the two listed above. The one I omitted from the order is the 5′-bio with the floppy overhang (which won’t ligate to anything). Once I get my second supply of money from IMSD I’ll order that oligo.