Monthly Archives: July 2012

Molecular Biology, sequences, Shotgun DNA Mapping

The unzipping adapter sequences

Leave a comment

Every time I order adapter sequences, I need to go through the same process. This page lists all the sequences used for the unzipping construct’s adapter duplex. The issue is that I only ever need two sequences: a top and a bottom. The top adapter is easy to pick, but the bottom adapter has two possible solutions and I always forget which one. For this I’ll need to reference some order forms to see what I used last time.

Anyways. The top adapter I need is:

  • Top Adapter BstXI/SapI – this adapter has the complementary overhangs for both the BstXI site on the anchor DNA and the SapI site on the unzipping DNA.

And it looks like the bottom adapter I need is the one labeled Bottom Adapter 1a. I’m guessing it is that because: (1) the top adapter on the page is shown annealed to this bottom, and (2) I reference it on this page.

Ok, I’ve verified that the bottom adapter I use most frequently is:

  • Bottom Adapter 1a – which I’ve most recently developed two versions of:
    • GAGCGGATXACTATACTACATTAGAATTCAGAC – this is the original sequence, and the X is actually a dT-biotin (dT is deoxyribonucleotide thymine)
    • TXTXTXAGAGCGGATTACTATACTACATTAGAATTCAGAC – Bottom Adapter 5′ biotin, floppy named because the TXTXTXA is an addition to the 5′ end of the original sequence. The X’s are dT-biotin
    • GAGCGGATTACTATACTACATTAGAATTCAGAC – Bottom 5′-biotin adapter named because I’ve removed the dT-biotin and put the biotin at the 5′ end of the sequence.

So unfortunately the verification process I went through is not open. I had to pull my order forms to Alpha DNA to confirm the sequences. Once I found and confirmed the sequences I emailed them to myself. And now I’m posting them here so the entire record is complete. ONS rules!

Anyway, I never remember what Bottom Adapter 1b is for, but I suppose it is not necessary. In the mean time I found a bunch of older notebook entries that contain information about the bottom adapters:

  • 11/4/09
  • BstXI adapter – I made an adapter to ligate the anchor to itself, and I reference the original bottom adapter called Bottom biotin. I don’t say which one it is, but I’m pretty sure it’s 1a.

I had some other links, but they were either confusing or referred to the bottom adapter without specifying each one. And it is tough searching OWW for the CATG version (1b). Maybe Koch knows? I’ll do some digging later. Research is fun!

Molecular Biology, Shotgun DNA Mapping

Shotgun DNA Mapping: The Unzipping Adapter

Leave a comment
Ignoring the circle, the adapter duplex (the middle piece, red) will be the topic of today’s discussion.

The ligation reaction that I keep referring to requires three pieces of DNA. They get fused together all in one shot, that is slightly complicated. The most crucial of which is the adapter duplex, because without it the anchor and the unzipping DNA would not attach and the reaction would yield nothing. And because of how important the adapter is, this has been the source of my troubles for the past 4 years. But before I go into that, let me tell you about the duplex.

It’s called an adapter duplex because it is actually two single stranded pieces of DNA. We call them the top and bottom strand. They are short DNA sequences manufactured from biotech companies. In the past we’ve used Alpha DNA, but I’m thinking of trying someone new. How short are the strands? The bottom strand has about 35 bases and the top is only a few bases longer. Compare that to the anchor sequence which is either 1100 bp (base pairs) or 4400 bp or the unzipping sequence which can be as long or as short as we want (but typically around 3000bp for calibration sequences).

Once our single stranded sequences arrive via mail (we call these short sequence oligonucleotides, or oligos for short), we need to bind the top and bottom strands together in a process called annealing. Most molecular biological reactions involve some kind of enzyme to help the reaction, but annealing is quite a natural process. DNA naturally wants the bases to bind to complementary bases (A-T, G-C) and even in single stranded form, the DNA will self anneal, that is bind to itself. So to get our top and bottom strands to stick together we just put them together in the same tube, heat it up to near boiling temperatures, and slowly bring the temp down so that the top and bottom strands find each other and bind. Once it’s cooled, the adapter duplex is formed and will stay that way unless heated to very high temperatures (near boiling).

There are three key features of the adapter duplex: (1) a biotin molecule, (2) a gap in the DNA backbone, and (3) two non-palindromic overhangs. The overhangs are designed to bind with a very specific sequence. One side can only bind with the overhang I mentioned in the anchor DNA, the other side can only bind with the overhang contained in the unzipping DNA. Right now that particular sequence is very specific to cutting plasmid pBR322 with the enzyme SapI (and any other plasmids that share similar properties).

The biotin is necessary for unzipping. The biotin has a high affinity for streptavidin which coats the microspheres we use for optical tweezing. Typically the biotin in our bottom adapter strand is near the start, but not at the start of the sequence. In more recent iterations, we moved it to the 5′ end completely or added a poly-A overhang with several biotin there. The reason for this is because we’ve been having issues actually unzipping, which I’ll explain in another post. The hope was that by moving the biotin we would get better tethering efficiency and better unzipping. We ended up not getting unzipping results and the tethering efficiency studies were inconclusive.

See wikipedia, DNA article

The bottom strand has both the biotin and the gap (key feature 2), which actually plays a role in the unzipping. Since the tweezers will pull on this side, the gap was designed to aid in the unzipping. Basically the gap was the weakest point in the complete DNA chain and since the microsphere is so close to it the DNA would begin to unzip from this location. The gap is actually a missing phosphorus (the yellow in the image to the right), which prevents the anchor and the bottom adapter strand from connecting to each other.  In later iterations we completely removed the first base to make the gap wider, and the poly-A tail I mentioned was also used to prevent there from being any attachment.

Ultimately I never got unzipping to work. Oddly enough, I ran experiments that verified the ligation reaction worked, but could never get the completed structure to unzip. That’s what this new set of experiments is going to attempt. But before I get to that, I need to tell you about the unzipping DNA portion!

Water Analysis, Water Type Effects on Organism Growth

D-exchange over time

Leave a comment

This is a follow up from the experiment on Thursday with results posted on Friday. At my request, Scott measured the exposed DDW sample over time on Friday and Saturday (I believe). He also made a concoction by mixing the DDW I gave him with some other water he labels as “1.28 at. % water.” I’m not sure of the ratios of DDW to mystery water but I’ll find out.

Either way, here are some preliminary results. Plotted above is the ratio of Deuterium to Oxygen-18 for each water sample. The pure DDW sample is to the left. As you can see, the amount of D and O-18 increases each day and is approaching natural water readings. I’d say that is to be expected. The mystery water that Scott made seems to have D and O-18 added to the water and those amounts are dropping back to the normal water range. If I’m understanding this correctly, I’d say that is to be expected as well. DI water is being measured as well and that sits right in the natural water range.

Some notes:

  • I’d say it would be pretty interesting to watch the D/O-18 ratio change daily for an extended period of time. I’d assume the fluctuations may be random daily.
  • It would be interesting to have some natural NM rain water and tap water compared with the DI water and watch those fluctuations.
  • I should find out what volume of water we’re dealing with. With regards to the Crumley experiments, I used 6mL of water. And for the yeast and e.coli experiments I  used 10mL of water. I think we are dealing with less in these experiments, so D-exchange might not be as prevalent as I assumed. The microbe experiments last a day, and the Crumley experiments were for two weeks, but were as isolated from the environment as possible.
  • We should track the evaporation rate.

There is a lot to consider in these experiments and right now, my brain is swirling with ideas and results. A planning meeting seems to be in order.

Molecular Biology, sequences, Shotgun DNA Mapping

Anchor DNA Sequences

Leave a comment

See here for the background behind everything contained below. Note: For now I’m going to link sequences from OWW here. I was going to put the entire sequence, but that would make this page sorta sloppy and it could get lost. So I’m going to make a page that contains all the sequences necessary for Shotgun DNA Mapping.

  • pRL574– This is a non-commercial plasmid provided by Robert Landick. We have a very small supply so I will have to do some cloning to make an infinite supply!
    • primers – according to notes that I have on OWW and Google Docs I’ve had success with F834-dig as the forward primer (and might be the only primer I have in the lab), R2008 and R1985 as the reverse primers. The difference between the two reverse primers is the length of the PCR sequence, which turns out to be a difference of 23bp.
  • pALS– designed by me, purchased and built by DNA 2.0. I’ should have enough for a few PCR reactions, but I may need to clone to replenish my stocks.
    • primers – primer R4500 would bind in two places on the plasmid so I made R4000 to fix this issue. I’ll have to check my paperwork to see which primer has the dig. I think it is supposed to be on the reverse end, but I can’t be sure.
Molecular Biology, Shotgun DNA Mapping

Shotgun DNA Mapping: The DNA Anchor

3 Comments
The complete unzipping structure being unzipped.

In order to unzip DNA, I need to create three pieces of DNA that I will then attach to each other through a ligation reaction. The first piece that I will discuss is the anchor DNA.

The anchor DNA is a very versatile piece of double stranded DNA (dsDNA). From this singular piece, we can choose to unzip DNA or stretch it because of a special sequence contained in the DNA near one end. I’ll get into this a little bit later. But first a couple of questions:

  1. Why is it called anchor DNA? The reason is because we use this piece of DNA to attach our entire structure to a glass surface. This is the point that anchors our DNA while we pull on it for either stretching or unzipping experiments. One of the bases is designed with a digoxigenin molecule attached to it and that base is placed right at the start of the sequence. In our tethering experiments, we coat our glass with an antibody for digoxigenin (dig for short), cleverly named anti-dig, and chemistry causes the anti-dig to bind with dig. You can understand a lot about antigen-antibody interactions here.
  2. How can we decide between stretching and unzipping? Because of how we designed the anchor DNA, we can stretch the anchor segment by default. That means once I produce anchor DNA I can tether it and begin stretching experiments. If we want to unzip DNA, then I take the anchor DNA and cut the end off (the side opposite the dig molecule) in a digestion reaction (more on this another time). That reaction gives me a small overhang (when one side of the DNA is longer than the other). From there I can perform a series of reactions that create the DNA sequence necessary to perform unzipping experiments. Notice that the anchor end is left unchanged, and that is what enables us to perform both stretching and unzipping experiments from this one piece of DNA.

Now the third question is, How do you make the anchor sequence? For this we need to know several sequences, possibly perform some cloning, and perform a reaction known as polymerase chain reaction, or PCR.

I’m not going to go into the details of what PCR is and how it works (google searching will reveal a lot more useful information than what I’d be willing to put here), but what I will say is that PCR allows me to make millions/billions of copies of a sequence of DNA starting with just a few strands of the original sequence and some short pieces of DNA called primers.

Our original sequence comes from plasmids. For the anchor sequence I have two possible starting points: pRL574 is a plasmid that dates back to Koch’s graduate days, and about a year and a half ago I created a brand new plasmid called pALS. Both plasmids are viable options, but serve slightly difference purposes:

  • pRL574 – for this plasmid we have several different sets of primers that allow us to make anchors of different lengths ~1.1kb and ~4.4kb. The 4.4kb sequence we use primarily for stretching experiments, while the 1.1kb sequence is used in unzipping experiments.
  • pALS – this plasmid only produces one length which is about 4kb. But this plasmid allows us to both unzip and stretch as I described above. It also has a couple of very unique features. First, if I cut it in the right spot, I can ligate the plasmid to itself through a special adapter sequence (to be described later). Second, it contains a sequence that is recognize by nucleosomes, that we could use for more complicated experiments down the road.

So as you can tell, I have some options available to me. Normally I would just pick one plasmid to work with, but I want to work with both and figure out which may be the more viable option down the road. In my next post, I’ll link to and list the sequences needed to make the anchor construct, with some explanations as to what everything is.

Open Notebook

A quick summary of what my PhD dissertation will consist of

2 Comments

I’ll elaborate once the IGERT proposal is submitted (just a couple weeks away, yay!), but here is my plan:

  1. Shotgun DNA Mapping Simulation
  2. Overstretching DNA in D2O and DDW and regular water
  3. observing forces of the crazy helicopter microbe from the river
  4. Open Notebook Science
  5. Deuterium Experiments – Repeating Crumley and yeast growth, water analysis studies

Item 3 is new to the list and shouldn’t be difficult and could potentially be really fun! The SDM simulation stuff could be time consuming but I started that effort back in March right before Spring break. And the DNA stretching stuff has been underway my entire career here at UNM and is about to be redeveloped starting next week or so.

Water Analysis, Water Type Effects on Organism Growth

Deuterium exchange analysis experimental planning

9 Comments

The future direction of the experiment using the ring down cavity spectroscopy device will be planned here. This should be a fun collaboration between Scott Jasechko (Earth and Planetary Sciences) and myself (Physics). Join the conversation!

 

Water Analysis, Water Type Effects on Organism Growth

An alternative analysis to FT-IR to study deuterium exchange

1 Comment

Via figshare:

Deuterium Content of Deuterium Depleted Water: 1st Trial. Anthony Salvagno, Scott Jasechko. figshare.
Retrieved 21:24, Jul 20, 2012 (GMT)
http://dx.doi.org/10.6084/m9.figshare.93089

A few days ago I made a new friend named Scott Jasechko. We met to discuss the possibility of creating a TED branded forum to UNM. We got to talking about our research and it turned out that our research interests are very much aligned and he studies water isotope amounts with relation to natural water around the planet. He’s about to publish his findings and once that goes through I’ll link to that.

It turned out that his lab has a device that can very accurately measure small concentrations of deuterium and oxygen-18 in water samples. I told him about my DDW experiments and how deuterium exchange may affect my experiments, but that I can’t quantitatively measure it’s affect or the process in general. So we got to talking and he wanted to help me out.

The data linked above is the results of the mini-collaboration that I predict will turn into more. Scott used his Picarro cavity ring down spectroscope, which means very little to me right now, to analyze the water samples I gave him. The water was used in these two experiments (each word is a separate link). And was then stored in our desiccator (with drierite to reduce moisture exchange) until yesterday (July 19, 2012).

Surprisingly, the data shows very little change from what Sigma claims (less than 1 part per million D to H) to yesterday, showing very little exchange. There are two things to consider here: (1) the machine wasn’t calibrated for such low levels of D, which skew the readings (since they actually give us negative ratios), and (2) volume may play a part in exchange.

I don’t understand the mechanism very well but I suspect that surface interactions play the largest role in deuterium exchange. Once deuterium is introduced into the sample, then I would guess diffusion takes over, but this is probably slower in nature than evaporation/other mechanisms that are involved on the surface. Basically this is a thermodynamics problem that I would need to spend 3 months thinking about to compare with experimental analysis (since that is how long the Thermo class is, 1 semester).

The follow up to this experiment should be better organized. Obviously we’ll need to redo this experiment. Scott and I are also performing another experiment where Scott has left the lid off the samples I gave him so he can see if there is a new value the spectroscope provides. From here we may want to do some longer time analysis and some other studies that we’ll have to plan. I’ll start a new thread for that, in the mean-time I hope he’ll introduce himself in the comments of this post.

Some other notes:

  • I geeked out when I realized the power of this sort of collaboration. If I hadn’t been affiliated with TEDxABQ and thus this new idea of TEDxUNM (not officially licensed), I would have never met Scott. These are the sorts of collaborations that I hope can be introduced because of the Open Research IGERT proposal.
  • I mega-geeked out when I realized I can do a project planning thread with someone here at the university in another lab that can also participate in the project! Open science at the core all the way.
  • I super-mega-geeked out when I realized that I implemented a crucial aspect of ONS. As I wrote this post I wondered what experiments I had used the water for. Then I realized that it’s all documented and that I can show everyone what those experiments are. It’s not enough that I have it recorded by date, but also that you all saw those experiments in real-time and their use in future experiments has been realized. That’s a major win for ONS.
KochLab Stuff, School

Candidacy Forms Map

Leave a comment

I’m basically making a “site” map so I can find the forms that I’ve been emailed and filled in, in case there are issues in the future, I can find them and pull them up again. Easily.

Here are the useful items:

  • AC_doctoral FORM-Salvagno.doc (My Documents on bioware) – this form is the most up to date form with my PhD credits moved to the Masters section (since they apply for both degrees) and 4 courses in the minor section (for the NSMS minor).
  • Email from ricoh, subject “Message from RNPEEED05,” date July 19 2012- contains the minor form signed but unfinished
  • Email from Alisa, subject “candidacy,” date July 18 2012 – contains information from OGS about minor and has form “AC_doctoral FORM-Salvagno Revision.doc” which moved a bunch of credits from the minor section to the PhD section. This will have to be moved back down in subsequent editions if it gets used.
  • Email from Heather and Alisa, subject “Minor Paperwork,” date July 17, 2012 – contains the minor form in .pdf (can’t save with fields filled in) and some conversations where I discover the Candidacy information never got submitted.
  • POS – Masters-Salvagno.doc (My Documents on bioware) – is the program of studies that I submitted for my Masters degree. Since I actually have the degree, this paperwork isn’t very useful anymore, but still worth noting where it is in case something goes down.
KochLab Stuff, School

Application for Candidacy: The struggle continues…

Leave a comment

There is almost no reason to write this post other than to document the fact that I am finalizing my paperwork for my PhD candidacy. Please don’t clap/cheer or congratulate me. There is quite a story about why I even need this post, but just know this is mostly for my own documentation. But if you are interested, here is the full story:

From Fall 2007-Spring 2010 I was an NSMS IGERT fellow. The NSMS IGERT created a degree program from the curriculum of the program. NSMS fellows could be either NSMS PhD students or students from outside the field. If they were from another department, those students would be eligible for a minor in NSMS. I fell into this category.

Unfortunately I didn’t complete the curriculum. There were 5 courses and due to time constraints I had to drop the last course. Doing so didn’t affect my Physics degree at all, but it did affect my eligibility for the NSMS minor.

Fast forward a short time later and I gave my candidacy presentation Fall 2010. With that came a bunch of annoying paperwork. But I got it done and presented and passed and the rest is history. Right?

Wrong!

I met with the NSMS program administrator last week to discuss my IGERT proposal. In a completely chance discussion, she mentioned to me that there was a recent rule change so that I would be eligible to receive the minor in NSMS. All I would need to do is attach a form to my candidacy paperwork and I’m in.

So I contacted the Physics admin to discuss the logistics and discovered that my candidacy paperwork never got filed. I’m not sure if it never was turned into the UNM Office of Graduate Studies (OGS), or if got lost, or what. I am sure that I filled it out and submitted it.

How you ask? Well last summer I submitted paperwork to receive an MS in Physics. The paperwork for that is identical to the application for candidacy, just with a different title. And I copy and pasted all the information from the candidacy form onto the master petition.

Regardless of what went down at my candidacy exam, some how there is no record of my application for candidacy being submitted and that is what I’m finalizing today. And since I document anything from this process in my open notebook, I can’t prove that the error was not my own. But now I am documenting it, so if there are any issues in the future I can point here and figure out what the issue is.

See, open notebook science works well for other things than just science.

And in case anyone is interested, here is a practice candidacy exam I created complete with audio: